<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	xmlns:georss="http://www.georss.org/georss" xmlns:geo="http://www.w3.org/2003/01/geo/wgs84_pos#" xmlns:media="http://search.yahoo.com/mrss/"
	>

<channel>
	<title>..on a mote of dust</title>
	<atom:link href="http://mygoldilocks.wordpress.com/feed/" rel="self" type="application/rss+xml" />
	<link>http://mygoldilocks.wordpress.com</link>
	<description>Celebrating the joy of being human</description>
	<lastBuildDate>Tue, 26 Jul 2011 06:47:34 +0000</lastBuildDate>
	<language>en</language>
	<sy:updatePeriod>hourly</sy:updatePeriod>
	<sy:updateFrequency>1</sy:updateFrequency>
	<generator>http://wordpress.com/</generator>
<cloud domain='mygoldilocks.wordpress.com' port='80' path='/?rsscloud=notify' registerProcedure='' protocol='http-post' />
<image>
		<url>http://1.gravatar.com/blavatar/9d4eff6b515f04724930b58805b8aaae?s=96&#038;d=http%3A%2F%2Fs2.wp.com%2Fi%2Fbuttonw-com.png</url>
		<title>..on a mote of dust</title>
		<link>http://mygoldilocks.wordpress.com</link>
	</image>
	<atom:link rel="search" type="application/opensearchdescription+xml" href="http://mygoldilocks.wordpress.com/osd.xml" title="..on a mote of dust" />
	<atom:link rel='hub' href='http://mygoldilocks.wordpress.com/?pushpress=hub'/>
		<item>
		<title>Where do I really come from?</title>
		<link>http://mygoldilocks.wordpress.com/2010/11/05/where-do-i-really-come-from/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/11/05/where-do-i-really-come-from/#comments</comments>
		<pubDate>Fri, 05 Nov 2010 12:46:21 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Discussions]]></category>
		<category><![CDATA[Evolution]]></category>
		<category><![CDATA[Science]]></category>
		<category><![CDATA[Genetics]]></category>
		<category><![CDATA[Genographic results]]></category>
		<category><![CDATA[Human migration]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=312</guid>
		<description><![CDATA[A few months ago, I have submitted my cheek epithelial cells to The Genographic Project lab. I had my mitochondrial DNA analyzed just because my maternal ancestry appears to be suspicious and more likely to be surprising. See where my many-times-great-grandmothers came from.. I belong to a specific branch called Haplogroup M* The map above shows the direction [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=312&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>A few months ago, I have submitted my cheek epithelial cells to The Genographic Project lab. I had my mitochondrial DNA analyzed just because my maternal ancestry appears to be suspicious and more likely to be surprising.</p>
<p>See where my many-times-great-grandmothers came from..</p>
<p><a href="http://mygoldilocks.files.wordpress.com/2010/11/result.jpg"><img class="aligncenter size-full wp-image-314" title="result" src="http://mygoldilocks.files.wordpress.com/2010/11/result.jpg?w=614&#038;h=333" alt="" width="614" height="333" /></a></p>
<p>I belong to a specific branch called <strong>Haplogroup M*</strong></p>
<p>The map above shows the direction that my maternal ancestors followed as they set out from their original homeland in East Africa <strong>about 60,000 years ago</strong>.</p>
<p><strong>Because its age is estimated at around 60,000 years old, members of this group were likely the first humans to leave Africa, and they likely did it heading east.</strong></p>
<div><strong>My haplogroup, M*, constitutes the other group that split off from L3, and gave rise to the first wave of modern humans to make a successful exodus from Africa.</strong> These people likely left the continent across the Horn of Africa, where a narrow span of water between the Red Sea and the Gulf of Adenseparates the East African coastline from the Arabian Peninsula at Bab-el-Mandeb. The short ten miles would have been easily navigable for humans possessing early maritime technologies.</div>
<p>This crossing constituted the start of a long coastal migration eastward across the Middle East and southern Eurasia, eventually reaching all the way to Australia and Polynesia.</p>
<p>Haplogroup M* is considered an east Eurasian lineage, as it is found at high frequencies east of the Arabian Peninsula. Members of this group are virtually absent in the Levant (a coastal region in what is now Lebanon), though they are present at higher frequencies in the south-Arabian Peninsula at around 15 percent.</p>
<p>Look at the recent map of the migration path including all the lineages until 10-5,000 B.C.</p>
<p><a href="https://genographic.nationalgeographic.com/genographic/lan/en/atlas.html">https://genographic.nationalgeographic.com/genographic/lan/en/atlas.html</a></p>
<p><a href="http://mygoldilocks.files.wordpress.com/2010/11/10000.jpg"><img class="aligncenter size-full wp-image-317" title="10000" src="http://mygoldilocks.files.wordpress.com/2010/11/10000.jpg?w=614&#038;h=371" alt="" width="614" height="371" /></a></p>
<p><strong>Complete result.</strong></p>
<p>Type : mtDNA<br />
Haplogroup : M*</p>
<p>Your Mitochondrial HVR I Sequence</p>
<p>16129A, 16203G, 16223T, 16264T, 16265C, 16519C&#8221;</p>
<table border="0" cellspacing="0" cellpadding="0" width="100%">
<tbody>
<tr>
<td>ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTA<br />
CCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATT<br />
ACTGCCAGCCACCATGAATATTGTAC<span style="color:#ecbf0d;"><strong>A</strong></span>GTACCATAAATACTTGACCACCTG<br />
TAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACA<span style="color:#ecbf0d;"><strong>G</strong></span>G<br />
CAAGTACAGCAATCAACC<span style="color:#ecbf0d;"><strong>T</strong></span>TCAACTATCACACATCAACTGCAACTCCAAAG<br />
CCACCCCT<span style="color:#ecbf0d;"><strong>T</strong></span><span style="color:#ecbf0d;"><strong>C</strong></span>CCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTAC<br />
ATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTT<br />
CTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCC<br />
TCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCC<br />
CATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTA<br />
CTTCAGGG<span style="color:#ecbf0d;"><strong>&#8220;</strong></span>CATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACA<br />
TCACGATG</td>
<td width="222" align="center" valign="middle"></td>
</tr>
</tbody>
</table>
<p>Key  <span style="color:#ffcc00;"> C</span> Subsitution(transition)  <span style="color:#ff6600;">C</span> Substitution(transversion)  <span style="color:#008000;">C</span> Insertion  _ Deletion</p>
<p>How to Interpret Your Results</p>
<p>At left is displayed the sequence of your mitochondrial genome that was analyzed in the laboratory. Your sequence is compared against the Cambridge Reference Sequence (CRS), which is the standard mitochondrial sequence initially determined by researchers at Cambridge, UK. The differences between your DNA and the CRS are highlighted, and these data allow researchers to reconstruct the migratory paths of your genetic lineage. Substitution (transition): a nucleotide base mutation in which a pyrimidine base (C or T) is exchanged for another pyrimidine, or a purine base (A or G) is replaced with another purine. This is the most common type of single point mutation. Substitution (transversion): a base substitution in which a pyrimidine base (C or T) is exchanged for a purine base (A or G), or vice versa. Insertion: a mutation caused by the insertion of at least one extra nucleotide base in the DNA sequence. Deletion: a mutation caused by the deletion of at least one extra nucleotide base from the DNA sequence.</p>
<p><strong>Your Branch on the Human Family Tree</strong></p>
<p>Your DNA results identify you as belonging to a specific branch of the human family tree called <strong>haplogroup <em>M*</em></strong>.</p>
<p>The map above shows the direction that your maternal ancestors followed as they set out from their original homeland in East Africa. While humans did travel many different paths during a journey that took tens of thousands of years, the lines above represent the dominant trends in this migration.</p>
<p>Over time the descendants of your ancestors were the first modern humans to leave Africa and headed east, moving across the Arabian Peninsula, through the Indian subcontinent and on to eastern Asia and Australasia. But before we can take you back in time and tell their stories, we must first understand how modern science makes this analysis possible.</p>
<p><strong>How DNA Can Help</strong></p>
<p><em>(To follow along, click <strong>See Your DNA Analysis</strong> above to view the data produced from your cheek scraping.)</em></p>
<p>The string of 569 letters shown above is your mitochondrial sequence, with the letters <em>A, C, T,</em> and <em>G</em> representing the four nucleotidesthe chemical building blocks of lifethat make up your DNA. The numbers at the top of the page refer to the positions in your sequence where informative mutations have occurred in your ancestors, and tell us a great deal about the history of your genetic lineage.</p>
<p>Here&#8217;s how it works. Every once in a while a mutationa random, natural (and usually harmless) changeoccurs in the sequence of your mitochondrial DNA. Think of it as a spelling mistake: one of the &#8220;letters&#8221; in your sequence may change from a <em>C</em> to a <em>T,</em> or from an <em>A</em> to a <em>G.</em></p>
<p><em>(Explore the <strong>Genetics Overview</strong> to learn more about population genetics.)</em></p>
<p>After one of these mutations occurs in a particular woman, she then passes it on to her daughters, and her daughters&#8217; daughters, and so on. (Mothers also pass on their mitochondrial DNA to their sons, but the sons in turn do not pass it on.)</p>
<p>Geneticists use these markers from people all over the world to construct one giant mitochondrial family tree. As you can imagine, the tree is very complex, but scientists can now determine both the age and geographic spread of each branch to reconstruct the prehistoric movements of our ancestors.</p>
<p>By looking at the mutations that <em>you</em> carry, we can trace your lineage, ancestor by ancestor, to reveal the path they traveled as they moved out of Africa. Our story begins with your earliest ancestor. Who was she, where did she live, and what is her story?</p>
<p><em>(Click <strong>Explore Your Route Map</strong> on the right side of the page to return to the map showing your haplogroup&#8217;s ancestral journey.)</em></p>
<p><strong>Your Ancestral Journey: What We Know Now</strong></p>
<p>We will now take you back through the stories of your distant ancestors and show how the movements of their descendants gave rise to your mitochondrial lineage.</p>
<p>Each segment on the map above represents the migratory path of successive groups that eventually coalesced to form your branch of the tree. We start with your oldest ancestor, &#8220;Eve,&#8221; and walk forward to more recent times, showing at each step the line of your ancestors who lived up to that point.</p>
<p><strong>Mitochondrial Eve: The Mother of Us All</strong></p>
<p>Ancestral Line: &#8220;Mitochondrial Eve&#8221;</p>
<p>Our story begins in Africa sometime between 150,000 and 170,000 years ago, with a woman whom anthropologists have nicknamed &#8220;Mitochondrial Eve.&#8221;</p>
<p>She was awarded this mythic epithet in 1987 when population geneticists discovered that all people alive on the planet today can trace their maternal lineage back to her.</p>
<p>But Mitochondrial Eve was not the first female human. <em>Homo sapiens</em> evolved in Africa around 200,000 years ago, and the first hominidscharacterized by their unique bipedal statureappeared nearly two million years before that. Though <em>Homo sapiens</em> have been around for about 200,000 years, about 150,000 to 170,000 years ago, a woman was born from whom we are all descended. This happened 30,000 years after <em>Homo sapiens</em> evolved in Africa.</p>
<p>Eventually, for any number of reasons, all of the other lineages of people went extinct, and &#8220;Mitochondrial Eve&#8221; as we call her, was the only female who had descendants that are now living in the present day. We can all be traced back to that one woman, who lived about 170,000 years ago.</p>
<p>Which begs the question, &#8220;So why Eve?&#8221;</p>
<p>Simply put, Eve was a survivor. A maternal line can become extinct for a number of reasons. A woman may not have children, or she may bear only sons (who do not pass her mtDNA to the next generation). She may fall victim to a catastrophic event such as a volcanic eruption, flood, or famine, all of which have plagued humans since the dawn of our species.</p>
<p>None of these extinction events happened to Eve&#8217;s line. It may have been simple luck, or it may have been something much more. It was around this same time that modern humans&#8217; intellectual capacity underwent what author Jared Diamond coined the Great Leap Forward. Many anthropologists believe that the emergence of language gave us a huge advantage over other early human species. Improved tools and weapons, the ability to plan ahead and cooperate with one another, and an increased capacity to exploit resources in ways we hadn&#8217;t been able to earlier, all allowed modern humans to rapidly migrate to new territories, exploit new resources, and outcompete and replace other hominids, such as the Neandertals.</p>
<p>It is difficult to pinpoint the chain of events that led to Eve&#8217;s unique success, but we can say with certainty that all of us trace our maternal lineage back to this one woman.</p>
<p><strong>The <em>L</em> Haplogroups: The Deepest Branches</strong></p>
<p>Ancestral line: &#8220;Eve&#8221; &gt; <em>L1/L0</em></p>
<p>Mitochondrial Eve represents the root of the human family tree. Her descendents, moving around within Africa, eventually split into two distinct groups, characterized by a different set of mutations their members carry.</p>
<p>These groups are referred to as <em>L0</em> and <em>L1,</em> and these individuals have the most divergent genetic sequences of anybody alive today, meaning they represent the deepest branches of the mitochondrial tree. Importantly, current genetic data indicates that indigenous people belonging to these groups are found exclusively in Africa. This means that, because all humans have a common female ancestor, &#8220;Eve,&#8221; and because the genetic data shows that Africans are the oldest groups on the planet, we know our species originated there.</p>
<p>Haplogroups <em>L1</em> and <em>L0</em> likely originated in East Africa and then spread throughout the rest of the continent. Today, these lineages are found at highest frequencies in Africa&#8217;s indigenous populations, the hunter-gatherer groups who have maintained their ancestors&#8217; culture, language, and customs for thousands of years.</p>
<p>At some point, after these two groups had coexisted in Africa for a few thousand years, something important happened. The mitochondrial sequence of a woman in one of these groups, <em>L1,</em> mutated. A letter in her DNA changed, and because many of her descendants have survived to the present, this change has become a window into the past. The descendants of this woman, characterized by this signpost mutation, went on to form their own group, called <em>L2.</em> Because the ancestor of <em>L2</em> was herself a member of <em>L1,</em> we can say something about the emergence of these important groups: Eve begat <em>L1,</em>and <em>L1</em> begat <em>L2.</em> Now we&#8217;re starting to move down your ancestral line.</p>
<p><strong>Haplogroup L2: West Africa</strong></p>
<p>Ancestral line: &#8220;Eve&#8221; &gt; <em>L1/L0</em> &gt; <em>L2</em></p>
<p><em>L2</em> individuals are found in sub-Saharan Africa, and like their <em>L1</em> predecessors, they also live in Central Africa and as far south as South Africa. But whereas <em>L1/L0</em> individuals remained predominantly in eastern and southern Africa, your ancestors broke off into a different direction, which you can follow on the map above.</p>
<p><em>L2</em> individuals are most predominant in West Africa, where they constitute the majority of female lineages. And because <em>L2</em>individuals are found at high frequencies and widely distributed along western Africa, they represent one of the predominant lineages in African-Americans. Unfortunately, it is difficult to pinpoint where a specific <em>L2</em> lineage might have arisen. For an African-American who is <em>L2</em>the likely result of West Africans being brought to America during the slave tradeit is difficult to say with certainty exactly where in Africa that lineage arose.</p>
<p>Fortunately, collaborative sampling with indigenous groups is currently underway to help learn more about these types of questions and to possibly bridge the gap that was created during those transatlantic voyages hundreds of years ago.</p>
<p><strong>Haplogroup L3: Out of Africa</strong></p>
<p>Ancestral line: &#8220;Eve&#8221; &gt; <em>L1/L0</em> &gt; <em>L2</em> &gt; <em>L3</em></p>
<p>Your next signpost ancestor is the woman whose birth around 80,000 years ago began haplogroup <em>L3.</em> It is a similar story: an individual in <em>L2</em> underwent a mutation to her mitochondrial DNA, which was passed onto her children. The children were successful, and their descendants ultimately broke away from the <em>L2</em> clan, eventually separating into a new group called<em>L3.</em> You can see above that this has revealed another step in your ancestral line.</p>
<p>While <em>L3</em> individuals are found all over Africa, including the southern reaches of sub-Sahara, <em>L3</em> is important for its movements north. You can follow this movement of the map above, seeing first the expansions of <em>L1/L0,</em> then <em>L2,</em> and followed by the northward migration of <em>L3.</em></p>
<p>Your <em>L3</em> ancestors were significant because they are the first modern humans to have left Africa, representing the deepest branches of the tree found outside of that continent.</p>
<p>Why would humans have first ventured out of the familiar African hunting grounds and into unexplored lands? It is likely that a fluctuation in climate may have provided the impetus for your ancestors&#8217; exodus out of Africa.</p>
<p>The African Ice Age was characterized by drought rather than by cold. Around 50,000 years ago the ice sheets of northern Europe began to melt, introducing a period of warmer temperatures and moister climate in Africa. Parts of the inhospitable Sahara briefly became habitable. As the drought-ridden desert changed to savanna, the animals your ancestors hunted expanded their range and began moving through the newly emerging green corridor of grasslands. Your nomadic ancestors followed the good weather and plentiful game northward across this Saharan Gateway, although the exact route they followed remains to be determined.</p>
<p>Today, <em>L3</em> individuals are found at high frequencies in populations across North Africa. From there, members of this group went in a few different directions. Some lineages within <em>L3</em> testify to a distinct expansion event in the mid-Holocene that headed south, and are predominant in many Bantu groups found all over Africa. One group of individuals headed west and is primarily restricted to Atlantic western Africa, including the islands of Cabo Verde.</p>
<p>Other <em>L3</em> individuals, your ancestors, kept moving northward, eventually leaving the African continent completely. These people currently make up around 10 percent of the Middle Eastern population, and gave rise to two important haplogroups that went on to populate the rest of the world.</p>
<p><strong>Haplogroup <em>M:</em> The Coastal Migrants</strong></p>
<p>Ancestral line: &#8220;Eve&#8221; &gt; <em>L1/L0</em> &gt; <em>L2</em> &gt; <em>L3</em> &gt; <strong><em>M</em></strong></p>
<p>Your next signpost ancestor is the woman whose descendants formed haplogroup <em>M.</em> Haplogroup <em>M</em> comprises one of two groups that were created from <em>L3.</em></p>
<p>One of these two groups, haplogroup <em>N,</em> moved north out of Africa and left the continent across the Sinai Peninsula, in present-day Egypt. Faced with the harsh desert conditions of the Sahara, their ancestors likely followed the Nile basin, which would have proved a reliable water and food supply in spite of the surrounding desert and its frequent sandstorms. The ancient members of haplogroup <em>N</em> spawned many sub-lineages that went on to populate much of the rest of the globe. They are found throughout Asia, Europe, India, and the Americas.</p>
<p>Your haplogroup, <em>M*,</em> constitutes the other group that split off from <em>L3,</em> and gave rise to the first wave of modern humans to make a successful exodus from Africa. These people likely left the continent across the Horn of Africa, where a narrow span of water between the Red Sea and the Gulf of Aden separates the East African coastline from the Arabian Peninsula at Bab-el-Mandeb. The short ten miles would have been easily navigable for humans possessing early maritime technologies. This crossing constituted the start of a long coastal migration eastward across the Middle East and southern Eurasia, eventually reaching all the way to Australia and Polynesia.</p>
<p>Haplogroup <em>M*</em> is considered an east Eurasian lineage, as it is found at high frequencies east of the Arabian Peninsula. Members of this group are virtually absent in the Levant (a coastal region in what is now Lebanon), though they are present at higher frequencies in the south-Arabian Peninsula at around 15 percent. Because its age is estimated at around 60,000 years old, members of this group were likely the first humans to leave Africa, and they likely did it heading east. Haplogroup <em>M</em> is found in East Africa, though at much lower frequencies than its subgroup <em>M1.</em> It gives the appearance of a more recent age in eastern Africa than in Asia which is likely the result of smaller populations in Africa, which would have reduced genetic diversity and would therefore appear more recent.</p>
<p>Your haplogroup is prevalent among populations living in the southern parts of Pakistan and northwest India, where it constitutes around 30 to 50 percent of the mitochondrial gene pool, depending on the population. Conversely, the <em>M*</em>haplogroup is absent or rarely found amongst people living west of the Indus Valley, and is found at low frequencies in the Central Asian populations, around 10 to 15 percent. The wide distribution and greater genetic diversity east of Indus Valley indicates that these haplogroup <em>M*-</em>bearing individuals are the legacy of the first inhabitants of southwestern Asia. These people underwent important expansions during the Paleolithic, and the fact that some East Asian haplogroup <em>M*</em>lineages match those found in Central Asia indicates much more recent (i.e., not founder) mixture into the area from the east.</p>
<p>Haplogroup <em>M*</em> has several sub-branches which exhibit some geographic specificity. Subgroup <em>M1</em> is found at high frequency in East Africa, at around 20 percent in many populations. Because haplogroup <em>M*</em> itself is almost entirely absent from the region, M1 individuals likely represent migrations back into the continent from the Arabian Peninsula after people had left Africa. <em>M2-M6</em> are characteristic Indian sub-groups. Haplogroup <em>M7</em> is distributed across the southern part of East Asia, and two of its own daughter-groups, <em>M7a</em> and <em>M7b2,</em> are representative of Japanese and Korean populations, respectively. <em>M7</em> individuals reach frequency in southern China and Japan of around 15 percent, and are found at lower frequencies in Mongolia. The old age of this branch indicates a pre-Jomon contribution to the mitochondrial gene pool in those areas.</p>
<p><strong>Anthropology vs. Genealogy</strong></p>
<p>DNA markers require a long time to become informative. While mutations occur in every generation, it requires at least hundredsnormally thousandsof years for these markers to become windows back into the past, signposts on the human tree.</p>
<p>Still, our own genetic sequences often reveal that we fall within a particular sub-branch, a smaller, more recent branch on the tree.</p>
<p>While it may be difficult to say anything about the history of these sub-groups, they do reveal other people who are more closely related to us. It is a useful way to help bridge the anthropology of population genetics with the genealogy to which we are all accustomed.</p>
<p>One of the ways you can bridge this gap is to compare your own genetic lineage to those of people living all over the world. <a href="http://www.mitosearch.org/" target="_ngo">Mitosearch.org</a> is a database that allows you to compare both your genetic sequence as well as your surname to those of thousands of people who have already joined the database. This type of search is a valuable way of inferring population events that have occurred in more recent times (i.e., the past few hundred years).</p>
<p><strong>Looking Forward (Into the Past): Where Do We Go From Here?</strong></p>
<p>Although the arrow of your haplogroup currently ends across Southeast Asia and Australia, this is not the end of the journey for haplogroup <em>M*.</em> This is where the genetic clues get murky and your DNA trail goes cold. Your initial results shown here are based upon the best information available todaybut this is just the beginning.</p>
<p>A fundamental goal of the Genographic Project is to extend these arrows further toward the present day. To do this, Genographic has brought together ten renowned scientists and their teams from all over the world to study questions vital to our understanding of human history. By working together with indigenous peoples around the globe, we are learning more about these ancient migrations.</p>
<p><strong><br />
</strong></p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/312/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/312/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/312/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/312/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/312/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/312/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/312/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/312/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/312/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/312/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/312/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/312/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/312/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/312/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=312&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/11/05/where-do-i-really-come-from/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>

		<media:content url="http://mygoldilocks.files.wordpress.com/2010/11/result.jpg" medium="image">
			<media:title type="html">result</media:title>
		</media:content>

		<media:content url="http://mygoldilocks.files.wordpress.com/2010/11/10000.jpg" medium="image">
			<media:title type="html">10000</media:title>
		</media:content>
	</item>
		<item>
		<title>Pseudoscientific Deepak Chopra</title>
		<link>http://mygoldilocks.wordpress.com/2010/09/13/deepak-chopra-successor-of-sai-baba/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/09/13/deepak-chopra-successor-of-sai-baba/#comments</comments>
		<pubDate>Mon, 13 Sep 2010 14:57:19 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Science]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=305</guid>
		<description><![CDATA[I think Deepak Chopra is intellectually challenged. He had an unfortunate confrontation with a physicist (co-author of The Grand Design), totally ruined his reputation. Enjoy..<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=305&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>I think Deepak Chopra is intellectually challenged. He had an unfortunate confrontation with a physicist (co-author of The Grand Design), totally ruined his reputation.</p>
<p>Enjoy..</p>
<span style="text-align:center; display: block;"><a href="http://mygoldilocks.wordpress.com/2010/09/13/deepak-chopra-successor-of-sai-baba/"><img src="http://img.youtube.com/vi/-y5D7q1O1Uk/2.jpg" alt="" /></a></span>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/305/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/305/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/305/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/305/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/305/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/305/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/305/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/305/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/305/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/305/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/305/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/305/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/305/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/305/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=305&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/09/13/deepak-chopra-successor-of-sai-baba/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>
	</item>
		<item>
		<title>We got a convert here? not really.</title>
		<link>http://mygoldilocks.wordpress.com/2010/09/02/we-got-a-convert-here-not-really/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/09/02/we-got-a-convert-here-not-really/#comments</comments>
		<pubDate>Thu, 02 Sep 2010 14:24:10 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Astronomy]]></category>
		<category><![CDATA[Science]]></category>
		<category><![CDATA[Stephen Hawking]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=287</guid>
		<description><![CDATA[The fact that we human beings – who are ourselves mere collections of fundamental particles of nature – have been able to come this close to an understanding of the laws governing us and our universe is a great triumph. &#8211; Stephen Hawking Stephen Hawking had an afterthought? I don&#8217;t think so. He never even [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=287&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<blockquote><p>The fact that we human beings – who are ourselves mere collections of fundamental particles of nature – have been able to come this close to an understanding of the laws governing us and our universe is a great triumph. &#8211; Stephen Hawking</p></blockquote>
<p><a href="http://www.guardian.co.uk/science/2010/sep/02/stephen-hawking-big-bang-creator">Stephen Hawking had an afterthought?</a> I don&#8217;t think so. He never even did admit that we can postulate a supernatural agency for the creation of the universe, on the contrary, those words about the mind of god in the book A Brief History Of Time was meant to be taken in the Einsteinian sense, none the less, it was willfully misunderstood by the deluded public. It is always nice to have some support from the greatest minds to backup your claim.</p>
<p>Anyway, a recap.. Darwin kicked him out of biology, Hawking kicks him out of Physics. We need to find a new role for [H]im. Don&#8217;t bother, Discovery Institute must be hiring new creationists to work on it.</p>
<p>Listen to this. slide it to 4:00</p>
<span style="text-align:center; display: block;"><a href="http://mygoldilocks.wordpress.com/2010/09/02/we-got-a-convert-here-not-really/"><img src="http://img.youtube.com/vi/rbdAe9kmkZ8/2.jpg" alt="" /></a></span>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/287/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/287/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/287/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/287/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/287/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/287/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/287/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/287/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/287/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/287/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/287/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/287/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/287/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/287/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=287&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/09/02/we-got-a-convert-here-not-really/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>
	</item>
		<item>
		<title>Brain eaters</title>
		<link>http://mygoldilocks.wordpress.com/2010/09/02/brain-eaters/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/09/02/brain-eaters/#comments</comments>
		<pubDate>Wed, 01 Sep 2010 16:49:29 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Evolution]]></category>
		<category><![CDATA[Grotesque life]]></category>
		<category><![CDATA[Science]]></category>
		<category><![CDATA[Phorid fly]]></category>
		<category><![CDATA[zombie fire ants]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=278</guid>
		<description><![CDATA[Take a look at another breathtaking breeding strategy. These decapitating phorid flies inject their eggs into the bodies of fire ants, once hatched the larva makes its way to the ant&#8217;s head, devours its brain, the brainless ant walks around aimlessly while the larva takes a ride sitting inside the ant&#8217;s head, the head falls [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=278&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p>Take a look at another breathtaking breeding strategy. These decapitating phorid flies inject their eggs into the bodies of fire ants, once hatched the larva makes its way to the ant&#8217;s head, devours its brain, the brainless ant walks around aimlessly while the larva takes a ride sitting inside the ant&#8217;s head, the head falls off and out comes the fly baby!</p>
<span style="text-align:center; display: block;"><a href="http://mygoldilocks.wordpress.com/2010/09/02/brain-eaters/"><img src="http://img.youtube.com/vi/6UThaL-D6U8/2.jpg" alt="" /></a></span>
<p>Ants are perhaps one of the most brutally exploited insects in the world.</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/278/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/278/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/278/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/278/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/278/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/278/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/278/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/278/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/278/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/278/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/278/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/278/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/278/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/278/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=278&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/09/02/brain-eaters/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>
	</item>
		<item>
		<title>Pea-sized frogs in Borneo, Malaysia</title>
		<link>http://mygoldilocks.wordpress.com/2010/09/01/pea-sized-frogs-in-borneo-malaysia/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/09/01/pea-sized-frogs-in-borneo-malaysia/#comments</comments>
		<pubDate>Tue, 31 Aug 2010 16:24:19 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Discussions]]></category>
		<category><![CDATA[Microhyla nepenthicola]]></category>
		<category><![CDATA[pea-sized frog]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=273</guid>
		<description><![CDATA[Take a look at this accidental discovery of a new species, pea-sized frogs found in Borneo carnivorous plants. Malaysia&#8217;s deforestation is shooting up at an alarming rate. 86% jump since 1990, generally due to the increasing demand for palm oil and industrialization.  I wonder how many species would have gone extinct without even we come [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=273&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p><a href="http://mygoldilocks.files.wordpress.com/2010/09/malaysia_mini_frogs_524682e.jpg"><img class="aligncenter size-medium wp-image-274" title="Malaysia_Mini_Frogs_524682e" src="http://mygoldilocks.files.wordpress.com/2010/09/malaysia_mini_frogs_524682e.jpg?w=300&#038;h=207" alt="" width="300" height="207" /></a></p>
<p>Take a look at this accidental discovery of a new species, <a href="http://www.statesman.com/news/nation/pea-sized-frogs-found-in-borneo-carnivorous-plants-880069.html">pea-sized frogs found in Borneo</a> carnivorous plants.</p>
<p>Malaysia&#8217;s deforestation is shooting up at an alarming rate. 86% jump since 1990, generally due to the increasing demand for palm oil and industrialization.  I wonder how many species would have gone extinct without even we come to know about them. Experts predict that if deforestation continues at todays rate, orangutans, the only great apes found outside Africa, will disappear forever in the next five years.</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/273/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/273/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/273/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/273/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/273/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/273/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/273/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/273/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/273/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/273/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/273/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/273/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/273/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/273/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=273&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/09/01/pea-sized-frogs-in-borneo-malaysia/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>

		<media:content url="http://mygoldilocks.files.wordpress.com/2010/09/malaysia_mini_frogs_524682e.jpg?w=300" medium="image">
			<media:title type="html">Malaysia_Mini_Frogs_524682e</media:title>
		</media:content>
	</item>
		<item>
		<title>Matt Ridley: When ideas have sex</title>
		<link>http://mygoldilocks.wordpress.com/2010/08/25/matt-ridley-when-ideas-have-sex/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/08/25/matt-ridley-when-ideas-have-sex/#comments</comments>
		<pubDate>Wed, 25 Aug 2010 07:27:30 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Evolution]]></category>
		<category><![CDATA[Matt Ridley]]></category>
		<category><![CDATA[When ideas have sex]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=266</guid>
		<description><![CDATA[<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=266&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<object width="446" height="326"><param name="movie" value="http://video.ted.com/assets/player/swf/EmbedPlayer.swf"></param><param name="allowFullScreen" value="true" /><param name="allowScriptAccess" value="always"/><param name="wmode" value="transparent"></param><param name="bgColor" value="#ffffff"></param> <param name="flashvars" value="vu=http://video.ted.com/talks/dynamic/MattRidley_2010G-medium.flv&su=http://images.ted.com/images/ted/tedindex/embed-posters/MattRidley-2010G.embed_thumbnail.jpg&vw=432&vh=240&ap=0&ti=915&introDuration=15330&adDuration=4000&postAdDuration=830&adKeys=talk=matt_ridley_when_ideas_have_sex;year=2010;theme=tales_of_invention;theme=unconventional_explanations;theme=a_taste_of_tedglobal_2010;theme=bold_predictions_stern_warnings;theme=new_on_ted_com;theme=the_rise_of_collaboration;theme=what_makes_us_happy;theme=the_creative_spark;event=TEDGlobal+2010;&preAdTag=tconf.ted/embed;tile=1;sz=512x288;" /><embed src="http://video.ted.com/assets/player/swf/EmbedPlayer.swf" pluginspace="http://www.macromedia.com/go/getflashplayer" type="application/x-shockwave-flash" wmode="transparent" bgColor="#ffffff" width="446" height="326" allowFullScreen="true" allowScriptAccess="always" flashvars="vu=http://video.ted.com/talks/dynamic/MattRidley_2010G-medium.flv&su=http://images.ted.com/images/ted/tedindex/embed-posters/MattRidley-2010G.embed_thumbnail.jpg&vw=432&vh=240&ap=0&ti=915&introDuration=15330&adDuration=4000&postAdDuration=830&adKeys=talk=matt_ridley_when_ideas_have_sex;year=2010;theme=tales_of_invention;theme=unconventional_explanations;theme=a_taste_of_tedglobal_2010;theme=bold_predictions_stern_warnings;theme=new_on_ted_com;theme=the_rise_of_collaboration;theme=what_makes_us_happy;theme=the_creative_spark;event=TEDGlobal+2010;"></embed></object>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/266/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/266/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/266/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/266/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/266/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/266/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/266/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/266/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/266/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/266/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/266/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/266/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/266/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/266/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=266&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/08/25/matt-ridley-when-ideas-have-sex/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>
	</item>
		<item>
		<title>Do you really exist?</title>
		<link>http://mygoldilocks.wordpress.com/2010/08/12/do-you-really-exist/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/08/12/do-you-really-exist/#comments</comments>
		<pubDate>Thu, 12 Aug 2010 08:07:04 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Discussions]]></category>
		<category><![CDATA[Grotesque life]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=257</guid>
		<description><![CDATA[Folks, you can be open minded but not too open that your brains fall out.  I like this quote from an old BBC series : When you think about it, nothing ever exists, in fact. I was working this out in the post office as I was waiting for that woman to finish twanging her [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=257&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p><a href="http://mygoldilocks.files.wordpress.com/2010/08/time.jpg"><img class="aligncenter size-full wp-image-259" title="time" src="http://mygoldilocks.files.wordpress.com/2010/08/time.jpg?w=232&#038;h=217" alt="" width="232" height="217" /></a></p>
<p>Folks, you can be open minded but not too open that your brains fall out.  I like this <a href="http://www.imdb.com/character/ch0030338/quotes">quote from an old BBC series</a> :</p>
<blockquote><p>When you think about it, nothing ever exists, in fact. I was working this out in the post office as I was waiting for that woman to finish twanging her elastic bands. <strong>The future doesn&#8217;t exist because it hasn&#8217;t happened yet; the past doesn&#8217;t exist because it&#8217;s already over. But the present doesn&#8217;t exist, because as soon as you start to think about it it&#8217;s already in the past. Which doesn&#8217;t exist any more.</strong></p></blockquote>
<p>See, that says it all! Sounds like a philosophical mumbo jumbo. But it makes sense in an ambiguous way. People can convince you with logical reasoning that you don&#8217;t exist!</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/257/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/257/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/257/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/257/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/257/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/257/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/257/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/257/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/257/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/257/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/257/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/257/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/257/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/257/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=257&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/08/12/do-you-really-exist/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>

		<media:content url="http://mygoldilocks.files.wordpress.com/2010/08/time.jpg" medium="image">
			<media:title type="html">time</media:title>
		</media:content>
	</item>
		<item>
		<title>Surrogates by nature</title>
		<link>http://mygoldilocks.wordpress.com/2010/08/11/surrogates-by-nature/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/08/11/surrogates-by-nature/#comments</comments>
		<pubDate>Wed, 11 Aug 2010 03:50:54 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Evolution]]></category>
		<category><![CDATA[Grotesque life]]></category>
		<category><![CDATA[Science]]></category>
		<category><![CDATA[parasitoid wasp]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=245</guid>
		<description><![CDATA[I cannot persuade myself that a beneficent and omnipotent being would have designedly created the Ichneumonidae with the express intention of their feeding within the living bodies of caterpillars. - Charles Darwin Imagine, you woke up one morning only to realize that Someone hijacked your body. Injected hundreds of their eggs. Disabled your natural anti-body [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=245&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<div id="_mcePaste">
<div id="_mcePaste"><a href="http://mygoldilocks.files.wordpress.com/2010/08/hornworm.jpg"><img class="aligncenter size-medium wp-image-246" title="hornworm" src="http://mygoldilocks.files.wordpress.com/2010/08/hornworm.jpg?w=300&#038;h=225" alt="" width="300" height="225" /></a></div>
<blockquote>
<div>I cannot persuade myself that a beneficent and omnipotent being would have designedly created the Ichneumonidae with the express intention of their feeding within the living bodies of caterpillars.</div>
<div id="_mcePaste">- Charles Darwin</div>
</blockquote>
</div>
<div>Imagine, you woke up one morning only to realize that</div>
<div>
<ul>
<li> Someone hijacked your body.</li>
<li> Injected hundreds of their eggs.</li>
<li> Disabled your natural anti-body with their biological weapon.</li>
<li> All happened within a fraction of a second without your knowledge.</li>
<li> Eggs hatch one day and the larvae feed on your living body.</li>
<li> From that day onwards little do you know that you eat not for you but for many and not your own.</li>
<li> One day, babies will eat-through your skin and break open your body and tiptoe away without a word of thanks.</li>
<li> Thanks? Not a big deal, you will be dead anyway.</li>
</ul>
</div>
<div>Quite a Sci-fi story huh?. Not really, <a href="http://www.newscientist.com/article/dn14053-zombie-caterpillars-controlled-by-voodoo-wasps.html">it actually happens to caterpillars all the time</a> that they learned to live with that!!</div>
<div>Have a look at this</div>
<div><span style="text-align:center; display: block;"><a href="http://mygoldilocks.wordpress.com/2010/08/11/surrogates-by-nature/"><img src="http://img.youtube.com/vi/vMG-LWyNcAs/2.jpg" alt="" /></a></span></div>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/245/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/245/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/245/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/245/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/245/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/245/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/245/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/245/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/245/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/245/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/245/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/245/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/245/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/245/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=245&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/08/11/surrogates-by-nature/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>

		<media:content url="http://mygoldilocks.files.wordpress.com/2010/08/hornworm.jpg?w=300" medium="image">
			<media:title type="html">hornworm</media:title>
		</media:content>
	</item>
		<item>
		<title>Matter flows from place to place and momentarily comes together to be you.</title>
		<link>http://mygoldilocks.wordpress.com/2010/08/10/matter-flows-from-place-to-place-and-momentarily-comes-together-to-be-you/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/08/10/matter-flows-from-place-to-place-and-momentarily-comes-together-to-be-you/#comments</comments>
		<pubDate>Tue, 10 Aug 2010 08:26:11 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Evolution]]></category>
		<category><![CDATA[Grotesque life]]></category>
		<category><![CDATA[Science]]></category>
		<category><![CDATA[Richard Dawkins]]></category>
		<category><![CDATA[Steve Grant]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=240</guid>
		<description><![CDATA[Here is an interesting thought from Steve Grant. In a desert plain in Tanzania, in the shadow of the volcano Ol Donyo Lengai, there&#8217;s a dune made of volcanic ash. The beautiful thing is that it moves bodily. It&#8217;s what&#8217;s technically known as a barchan, and the entire dune walks across the desert in a [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=240&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p><a href="http://mygoldilocks.files.wordpress.com/2010/08/black-hole-625x450.jpg"><img class="aligncenter size-medium wp-image-241" title="black-hole-625x450" src="http://mygoldilocks.files.wordpress.com/2010/08/black-hole-625x450.jpg?w=300&#038;h=216" alt="" width="300" height="216" /></a></p>
<p>Here is an interesting thought from Steve Grant.</p>
<p>In a desert plain in Tanzania, in the shadow of the volcano Ol Donyo Lengai, there&#8217;s a dune made of volcanic ash. The beautiful thing is that it moves bodily. It&#8217;s what&#8217;s technically known as a barchan, and the entire dune walks across the desert in a westerly direction at a speed of about 17 meters per year. It retains its crescent shape and moves in the direction of the horns. What happens is that the wind blows the sand up the shallow slope on the other side, and then, as each sand grain hits the top of the ridge, it cascades down on the inside of the crescent, and so the whole horn-shaped dune moves.</p>
<p>Steve Grand points out that you and I are, ourselves, more like a wave than a permanent thing. He invites us, the reader, to <em>&#8220;think of an experience from your childhood &#8212; something you remember clearly, something you can see, feel, maybe even smell, as if you were really there. After all, you really were there at the time, weren&#8217;t you? How else would you remember it? But here is the bombshell: You weren&#8217;t there. Not a single atom that is in your body today was there when that event took place. </em><strong><em>Matter flows from place to place and momentarily comes together to be you. Whatever you are, therefore, you are not the stuff of which you are made.</em></strong><em> If that doesn&#8217;t make the hair stand up on the back of your neck, read it again until it does, because it is important.&#8221;</em></p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/240/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/240/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/240/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/240/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/240/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/240/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/240/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/240/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/240/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/240/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/240/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/240/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/240/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/240/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=240&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/08/10/matter-flows-from-place-to-place-and-momentarily-comes-together-to-be-you/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>

		<media:content url="http://mygoldilocks.files.wordpress.com/2010/08/black-hole-625x450.jpg?w=300" medium="image">
			<media:title type="html">black-hole-625x450</media:title>
		</media:content>
	</item>
		<item>
		<title>Sense of obligation.</title>
		<link>http://mygoldilocks.wordpress.com/2010/08/09/sense-of-obligation/</link>
		<comments>http://mygoldilocks.wordpress.com/2010/08/09/sense-of-obligation/#comments</comments>
		<pubDate>Mon, 09 Aug 2010 06:03:53 +0000</pubDate>
		<dc:creator>Sajid</dc:creator>
				<category><![CDATA[Evolution]]></category>

		<guid isPermaLink="false">http://mygoldilocks.wordpress.com/?p=228</guid>
		<description><![CDATA[I was glossing over Jared Diamond&#8217;s Guns, Germs and Steel last night. It was an excellent book, well researched. I had a quaint feeling of affinity for our deep ancestors who crossed hundreds of channels, some of which was at least 50 miles wide, and ended up in the remote and exotic places, with one [...]<img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=228&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" />]]></description>
			<content:encoded><![CDATA[<p><a href="http://mygoldilocks.files.wordpress.com/2010/08/human-migration.jpg"><img class="aligncenter size-medium wp-image-232" title="Human migration" src="http://mygoldilocks.files.wordpress.com/2010/08/human-migration.jpg?w=300&#038;h=197" alt="" width="300" height="197" /></a></p>
<p>I was glossing over Jared Diamond&#8217;s Guns, Germs and Steel last night. It was an excellent book, well researched. I had a quaint feeling of affinity for our deep ancestors who crossed hundreds of channels, some of which was at least 50 miles wide, and ended up in the remote and exotic places, with one ultimate goal, survival of their gene.</p>
<p>We are apes who almost went extinct fifteen million years ago in competition with better evolved monkeys. We are primates, a group of mammals who almost went extinct forty-five million years ago in competition with the better evolved rodents, and so on. If you trace back our evolutionary history, we were at the brink of extinction much often than one would expect.</p>
<p>Millions of years ago. there lived in Africa a few bunch of humans evolved from early apes. Some of them kind enough to look for better environments for survival. They even took high risk of crossing mountains and rivers in harsh environments. Kind, because they carried our genes for generations so that we all could be here today talking about this. Until a few hundred years ago, among the large number of our species who survived, none of them knew what had actually happened.</p>
<p>The reason is clear, our ancestors were all looking for immediate opportunities, no foresight beyond one generation. I mean, one who started off this incredible journey from Africa had no idea that their descendants are going to be end up in Eurasia or Australia or America. With the very limited knowledge they had they could only visualize one or two generations to conclude anything at all! Evolution doesn&#8217;t really work in time, it works in generations. We are talking about hundreds of thousands of generations. Scientists estimate that we are about 300,000 generations away from our immediate common ancestor with chimpanzees.</p>
<p>Having said that, something was driving them to survive, nurture and preserve their genes, reproduce, help their children to survive too, deep kinship with the like ones and what not. This behavior of preserving their own gene was arguably the most important thing shaped by evolution alone. You can find this altruism in all the living things on earth, one way or the other.</p>
<p>And today, just as recent as a few hundred years, our brain helped us to understand what the hell was going on. Our deep ancestors are communicating to us through the sands of geological time. If you listen carefully enough, you can hear their voices.</p>
<p>And here we are looking back and say.. &#8220;Ohhh no no no.. evolution is all  nonsense. All the fossil evidences are hoax, molecular evidence doesn&#8217;t really work.. carbon dating was a joke&#8230; <a href="http://www.youtube.com/watch?v=m7qtzGtzTo4">DNA</a>? I have no idea what the hell you are talking about, but I know that you are wrong whatsoever&#8221;.</p>
<p>It is an insult to those who escaped from Africa from the dry climate to help us to exists today. Makes no difference from a parent who ignores an infant who has limited means of communication. Morally, we are liable to listen to their voices. Thank them, acknowledge them. Learn about them. Learn where we came from.</p>
<p>We are only half a chromosome away from chimpanzees.</p>
<br />  <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gocomments/mygoldilocks.wordpress.com/228/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/comments/mygoldilocks.wordpress.com/228/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godelicious/mygoldilocks.wordpress.com/228/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/delicious/mygoldilocks.wordpress.com/228/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gofacebook/mygoldilocks.wordpress.com/228/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/facebook/mygoldilocks.wordpress.com/228/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gotwitter/mygoldilocks.wordpress.com/228/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/twitter/mygoldilocks.wordpress.com/228/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/gostumble/mygoldilocks.wordpress.com/228/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/stumble/mygoldilocks.wordpress.com/228/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/godigg/mygoldilocks.wordpress.com/228/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/digg/mygoldilocks.wordpress.com/228/" /></a> <a rel="nofollow" href="http://feeds.wordpress.com/1.0/goreddit/mygoldilocks.wordpress.com/228/"><img alt="" border="0" src="http://feeds.wordpress.com/1.0/reddit/mygoldilocks.wordpress.com/228/" /></a> <img alt="" border="0" src="http://stats.wordpress.com/b.gif?host=mygoldilocks.wordpress.com&amp;blog=8537443&amp;post=228&amp;subd=mygoldilocks&amp;ref=&amp;feed=1" width="1" height="1" /><div class="sharedaddy sd-rating-enabled sd-like-enabled"></div>]]></content:encoded>
			<wfw:commentRss>http://mygoldilocks.wordpress.com/2010/08/09/sense-of-obligation/feed/</wfw:commentRss>
		<slash:comments>0</slash:comments>
	
		<media:content url="http://1.gravatar.com/avatar/5569bf0a88ac7928018cf6ef0977e4cf?s=96&#38;d=identicon&#38;r=G" medium="image">
			<media:title type="html">Sajid</media:title>
		</media:content>

		<media:content url="http://mygoldilocks.files.wordpress.com/2010/08/human-migration.jpg?w=300" medium="image">
			<media:title type="html">Human migration</media:title>
		</media:content>
	</item>
	</channel>
</rss>
